The Controversial Issues Of Young People Using Internet...

Nowadays, technologies of internet and mobile media has been widely used. The consequences of them on young people are powerful, however it has been an argumentative issue throughout years as the impacts contain both positive and negative sides. Based on the data from American life Project, there is an increasing rate of young people using smartphones and online social networking site such as Facebook, Twitter. This essay focuses on the controversial issues of young people using internet and communication technologies, whether this should be concerned or not. The misuse of internet by young people will certainly causes problems, however research shown that internet is becoming a part of daily life for them and they should be educated rather than prohibiting them from using online technologies. Moreover, different critical ideas about young people using internet technology will be discussed, with the support of different researches and the film ‘The Social Network’. It i s believed that the use of online and mobile media technologies by teenagers should be a concern because it has risks which impact on adolescents’ minds and behaviours adversely. First, the most important concern is moral panic, followed by cyberbullying and online harassment, less face to face communications, addictive to online social networking and privacy issues also happen when online technologies are used widely but not wisely. Firstly, moral panic refers to the adverse social and illegalShow MoreRelatedThe Overuse of Technology in Our Daily Life Essay1452 Words   |  6 Pagesof negative answers, and of course if we ask this question in a survey, â€Å"NO† will be the winner of this survey. Talking about the use of technology reminded me one of the sources from my annotated bibliography by Amy Petersen, who is the Theatre and Media Arts Department Chair and Associate Professor in the College of Fine Arts and Communications at Brigham Young University. In her article which she wrote about the overuse of tech in our daily life and its affects, she said â€Å"If you would have toldRead More Pornography on the Internet Essay1710 Words   |  7 PagesPornography on the Internet The Internet is a method of communication and a source of information that is becoming popular among those who are interested in the information superhighway. The problem with this world we know as Cyberspace, the ‘Net, or the Web is that some of this information, including pornographical material and hate literature, is being accessible to minors. Did you know that 83.5% of the images available on the Internet are pornographical? Did you know that the Internet’sRead MoreMass Media Communication1719 Words   |  7 Pagesprint media, like newspapers and magazines. Internet media can also attain mass media status, and many media outlets maintain a web presence to take advantage of the ready availability of Internet in many regions of the world. Some people also refer to it as the â€Å"mainstream media,† referencing the fact that it tends to stick to prominent stories which will be of interest to a general audience, sometimes ignoring controversial breaking news. Many people around the world rely on this form of mediaRead MoreThe Impact Of Online Media On The Society Of Bangladesh1589 Words   |  7 PagesBackground Recently we can see that online newspapers , blogs and social medias are playing a vital role in Bangladeshi society. They become sources of controversial issues , they become the catalyst of mass protest , they are now the medium of becoming united to raise voice against violations and again they are also used or exploited to do some kind of violations. Increasing number of Facebook and blog users in Bangladesh is creating some incidents those indicate that the pattern of public responsesRead MoreThe Arrival And Proliferation Of Technology1330 Words   |  6 Pagesproliferation of technologies that are created leads to one understanding of a social adept community with a developed connection, an effective communication with others, and an understanding of cultures. With societal innovation and the combination of technology and the internet, it introduced a social connection and efficient platform for the community. On the other hand, one may understand that such technological a dvances cause people to be distracted and isolated. In such a spectrum, people may thinkRead MoreCensorship Is Not Limited Repressive Regimes Or Network Television?1522 Words   |  7 Pagesmusic and as students we see the internet being heavily censored in school. The Children’s Internet Protection Act (CIPA) was signed into law in 2000; the law requires any public schools or library to filter any inappropriate content from the computers being used by minors. Since the law has been put in place, schools across America have installed programs that use keywords to designate certain types of websites off-limits to students while using the schools internet server. The problem with theseRead MoreThe Digital Footprint Is The Evidence Of A Technology Users Actions1641 Words   |  7 PagesA â€Å"Digital Footprint† is the evidence of a technology user’s actions. Every online activity leaves traces behind, which can be searched, referenced and used in ways as varied as the people who might do that searching. Learning and following the basic rules of Digital Citizenship minimizes the often negative impact of a broad Digital Footprint, and helps to create a productive and satisfying digital community. American students may feel as though they have a right to privacy, but in the online worldRead MoreTerrorism Is A Budding Problem1395 Words   |  6 Pagesthe present world. It has been a big issue since the events of 9/11. There are numerous terrorist organizations in the world today. Three of these organization are responsible for most of the terrorist attack today. These organizations are Al Qaeda, Taliban and ISIS. These organization orchestrate most of the attacks that happen today. According to New York Times, the numerous attacks that happened in Paris, that killed 130 people, Egypt, that killed 224 people and the Orlando night club shootingRead MoreIs Internet Addiction Disorder? Essay1483 Words   |  6 Pages Internet addiction disorder, more commonly called problematic Internet use, refers to excessive computer use which interferes with daily life. Internet overuse, problematic computer use, or pathological computer use, problematic Internet use, or Internet addiction di sorder. In the most recent version of the DSM-5, Internet Gaming Disorder is the latest term to describe this problem. History IAD was originally proposed as a disorder in a satirical hoax by Ivan Goldberg, M.D., in 1995, althoughRead MoreFreedom of Speech vs. Censorship on the Internet2126 Words   |  9 PagesSpeech Vs. Censorship: Children on the Internet The internet is a very controversial communication device in today’s society. If desired, one could find information on nearly any topic they choose. Censorship and free speech is a widely discussed topic when dealing with the current freedom of the internet especially when dealing with young minds. Should the internet have censored topics which would be illegal to post and/or view freely by children? Should the internet be a free-for-all arena in which anyone

Business Ethics And Social Responsibility - 879 Words

Business Ethics and Social Responsibility During this short summer class, I have understood more than I ever could have done before. Not only because the study of ethics is crucial, but also because being socially responsible is part of being ethical. Among the most important assignments required from this course are: Journals, discussion boards, social project, and the lectures. However, the first group collaboration was our own code of ethics; from there, students were required to follow it as part of the course. Once our instructor processed all the information provided, she decided to post it, and I would like to share the ones I like the most: †¢ I will be aware of deadlines and start early enough to allow time for questions to be asked and answered before assignments are due (because there is no excuse for ignorance). †¢ I will read carefully and refrain from rushing to judgment (the J word is so powerful that sometimes we judge before gathering the facts). †¢ Students will be expected to maintain a high level of honesty and transparency through this class. It is expected that this same level of honesty will be carried throughout the college career (and I would add â€Å"to the rest of my life†). Although every institution should carry a code of conduct or ethics, companies like Enron challenged its own code to become one of the most notorious cases of corruption, greed, and, conflict of interest. According to the textbook, ethics is simply defined as â€Å"how† humans shouldShow MoreRelatedSocial Responsibility And Business Ethics Essay1470 Words   |  6 Pagesrole of social responsibility in business organizations and society. This paper will compare similarities and differences between Cohen’s perspective on social responsibility to the social responsibility and business ethics theories of Drucker and Milton Friedman. Furthermore, this paper will provide a frame of reference on corporate social responsibility and business ethics presented in other research. Social Responsibility Defined Cohen, 2009 wrote in his article that Drucker defined social responsibilityRead MoreBusiness Ethics And Social Responsibility1167 Words   |  5 PagesCOMPARITIVE BUSINESS ETHICS AND SOCIAL RESPONSIBILITY Essay on Ethics and corporate Social Responsibilities SUBMITTED BY: Karuna Shrestha SID# TIA2346 SUBMITTED TO: Understanding Ethics and CSR (Corporate Social Responsibilities) Corporate social responsibility is no more characterized by the amount of cash an organization adds to charities, yet by its general inclusion in exercises that enhance the nature of individuals lives. Corporate Responsibility has come up as a huge topic in theRead MoreBusiness Ethics And Social Responsibility1828 Words   |  8 PagesIntroduction Businesses nowadays hold a lot of responsibility when developing and selling products/service ethically. Business ethics is the discussion that many scholars are talking about in securing a business’s reputation and success. In this paper, I will be tackling the surrounding ideals when it’s comes to business ethics and how a business should be run in order to have social responsibility. In addition, the theories that are based around these topics will be added into a scholarly debateRead MoreBusiness Ethics and Social Responsibility665 Words   |  3 PagesBusiness Ethics and Social Responsibility Sexual orientation discrimination includes being treated differently or harassed because of your real or apparent sexual orientation -- whether gay, lesbian, bisexual, or heterosexual. This type of discrimination may be illegal in your workplace, depending on where you work. This is not a personal problem that should be handled among themselves. As an Equal Employment Opportunity company, the company should ensure that guidelines are given andRead MoreBusiness Ethics and Social Responsibility Essay1471 Words   |  6 PagesEthics in the workplace help the organization to grow and prosper. They bring about leadership, work culture and literacy. Ethic are beliefs about what’s right or wrong and good or bad based on individual’s values and morals, plus a behavior social context. Ethical behavior conforms to individual beliefs and social norms about what’s right and good. Unethical behavior conforms to individual beliefs and social norms about whatâ€⠄¢s wrong or bad. Business ethics refers to ethical or unethical behaviorRead MoreBusiness Ethics And Corporate Social Responsibility Essay1382 Words   |  6 PagesSOLUTION Business Ethics Business ethics are moral principles that guide the way a business behaves. The same principles that determine an individual’s actions also apply to business. Acting in an ethical way involves distinguishing between â€Å"right† and â€Å"wrong† and then making the â€Å"right† choice. It is relatively easy to identify unethical business practices. For example, companies should not use child labor. They should not unlawfully use copyrighted materials and processes. They should not engageRead MoreBusiness Ethics : Moral And Social Responsibility1750 Words   |  7 PagesBusiness ethics are moral and social responsibility that a business is supposed to have towards the community in general. Many companies are concerned about their social responsibility, particularly to the environment and their employees. Our values and morals are our personal guidelines that help us make decisions about what is right and what is wrong. Most companies have policies and procedures it is important for managers and employees to have guidelines to follow in the workplace. I think weRead MoreBusiness Ethics and Social Responsibility Essay233 3 Words   |  10 Pagesvarious interpretations of four separate authors in respect to ethics and social responsibility as they apply to business. The four articles to be reviewed are; â€Å"The Social Responsibilities of Business is to Increase its Profits† by Milton Friedman, â€Å"The Relevance of Responsibility to Ethical Business Decisions† by Patrick E. Murphy, â€Å"What is ‘business ethics’† by Peter F. Drucker and â€Å"To Be Ethical Not To Be: An International Code of Ethics for Leadership† by Ala’ Alahmad. Each of these articles representsRead MoreBusiness Ethics And Corporate Social Responsibility1502 Words   |  7 Pages Nowadays, a business wants to exist and grow in a society, which business ethics and corporate social responsibility are sensitive and crucial objectives, the business should do what is right. Many people agree that business does not exist beyond society, it is a citizenship in the society. Therefore , business has to have many certain obligations and social responsibility. It generally means business have to do something good for the community, making social contribution, and using effectivelyRead MoreCorporate Social Responsibility And Business Ethics8391 Words   |  34 Pages CORPORATE SOCIAL RESPONSIBILITY AND BUSINESS ETHICS Final Project Report for Legal Aspects of Management Submitted To Prof. Dr. D.S. Sengar Professor, IIM Lucknow Submitted By Group 9 Abhinav Bansal, PGP31186 Chheda Adarsh Jayesh, PGP31199 Manideep Akarapu, PGP31213 Ritika Srivastava, PGP31226 Surbhi Aggarwal, PGP31239 â€Æ' Table of Contents Executive Summary 3 Acknowledgement 4 Business Ethics 5 Corporate Social Responsibilty 7 CSR Law 7 Crisis Management CSR 10

Challenges of hr prospects free essay sample

Abstract Human resource element works towards the Vision, Mission and Goals of an organization. The three roles of HRM in any organization are transactional, transformational, and transitional. The challenges faced by human resource managers in India are naturally evolving with the ever-transforming scenario in corporate India. Some of the major challenges which HR faces in India today are discussed hereunder. Key words: Challenges, Human Resource, Talent, changes. Introduction Human resources are the life blood of an organization. Despite the application of technology in modern business management, human resources are still relevant and most adaptive resources of the organization. The essential attribute of HR assist the enterprise to make rightful decisions and respond effectively to the threats and opportunities within the environment of the organization. Thus the enterprise depends highly on its HR for success and survival. The management of HR is complex and problematic because the individuals as workers hardly adapt or voluntarily embrace the objectives of the organization. As individuals, the employees have needs, aspirations, motivations, desires and interests which influence their behaviour at work. Human Resources Management and Planning are useful tools employed in harmonizing the needs of the employees with the goals and objectives of the organization on a continuous basis. The Challenges of Human Resource Management in a Globalised Economy The competitive pressures faced by the modern day enterprise for survival and success due to globalization and liberalization will continue to create room for future demand for organisational excellence. The new, global, complex, and often chaotic world of the Multi- national Enterprises requires a new strategic focus and new capabilities from HR just as it does from other management functions. Today’s top 10 Human Resource Management Challenges Due to the fluctuating economy as well as local and global advancements, there are many changes occurring rapidly that affect HR in a wide range of issues. In the Survey of Global HR Challenges: Yesterday, Today and Tomorrow, disclosed the following top 10 human resource management challenges: Challenges % of Companies 1. Change management 48% 2. Leadership development 35% 3. HR effectiveness measurement 27% 4. Organizational effectiveness 25% 5. Compensation 24% 6. Staffing: Recruitment and availability of skilled local labor 24% 7. Succession planning 20% 8. Learning and development 19% 9. Staffing: Retention 16% 10. Benefits costs: Health welfare 13% Facing Modern HR Challenges Head on: The proliferation of technology and changes in the business environment have increased the importance of human resources in the modern world. The major challenges facing human resources arise from this elevation of human resource activities to a core strategic function. Managing Globalization It is important for an HR Manager to study people management practices before implementing new practices which are global in nature. It has become a challenge for the HR to educate its workforce on how globalization can be leveraged and how an individual employee benefits or is affected by it. Instead of thrusting new practices upon them, it is ideal to study the existing practices which are in place. Developing Leadership Skills It is not just about knowledge, experience and expertise it is also about developing the right soft skills to give shape to the future leaders. Since the global economic and industrial scenario is very volatile and dynamic, what is required now is a skill set in the workforce which distinguishes them as team leaders. Finding and Retaining Talent The primary challenge facing human resource is to have the right people ready at the right time at the right place. The human resources of an enterprise, hitherto considered as just another resource such as land or capital, are now the key differentiator among firms, and as such the most critical source of competitive advantage. The increased competitiveness among firms ensures that finding new ways to increase the level of talent in the organization remains the key challenge facing human resources. Retaining existing talent is easier than hiring new employees. Possible interventions include custom-made compensation packages and fringe benefits, job enrichment, autonomy, better working conditions, and more. Ensuring Employee FIT Ways to ensure employee-organization fit include selecting employees based on the ability to do the job hiring employees who value teamwork and who can work with other employees hiring employees whose personal values and outlook match organizational values and culture Firms have 7. 5 percent higher revenue growth, 6. 1 percent higher profit growth, and 17. 1 percent lower turnover compared to firms that do not adopt this strategy. Ensuring Employee Competence The dimensions of HR challenges in this regard include: Understanding the employee’s innate skills and competencies and providing employees with opportunities to apply these skills for the benefit of the organization Skill enhancement of the workforce to promote adaptability, resilience, and agility Adopting a market driven approach. Adopting a Bottom -Line Oriented Approach Another major challenge facing human resources is to integrate its functional activities with the company’s strategic goals. This entails taking a bottom-line oriented approach while making decisions or framing policy. The key role of human resources in overcoming such challenge includes: Devising and implementing various motivational approaches, heralding a shift from performance-oriented pay to results-oriented remuneration or gain-sharing. Changing employee mindset from a process-oriented approach to a customer-oriented approach. Initiatives such as Total Quality Management, Six Sigma, and the like play a major role in this regard. Managing Diversity Managing diversity ranks among the most underestimated challenges confronting human resource. The dimensions of workplace diversity include age, ethnicity, gender, physical abilities, race, sexual orientation, educational background, geographic location, income, marital status, religious beliefs, parental status, and experience. A key challenge facing human resources is to manage and retain such diverse talent. The dimensions of workforce diversity challenge include: Reconciling the corporate culture to accommodate diversity and individual sensitivities Thinking globally and acting locally, by being responsive to the culture of the region, adapting to the societal requirements of host societies, and complying with local labor legislations. Managing Change Change is the only constant in today’s business environment, forcing organizations to keep pace with such changes constantly and rapidly to exploit new opportunities. Change takes the shape of organizational restructuring, mergers and acquisitions, right sizing, implementing outsourcing, providing telecommuting opportunities for employees, and the like. Focused change intervention increases productivity, improves organizational communications, improves process efficiency, improve quality, and raises employee morale. The challenges related to change for human resource management include: Helping employees overcome resistance to change by convincing them about the bigger picture Provide leadership for the change processes Ensuring stability of systems and processes during the change process Equipping employees to deal with the changed realities. Conclusion The role of the HR manager must parallel the needs of the changing organization. Successful organizations are becoming more adaptable, resilient, quick to change directions, and customer-centered. Within this environment, the HR professional must learn how to manage effectively through planning, organizing, leading and controlling the human resource and be knowledgeable of emerging trends in training and employee development. References

Oligopoly

Oligopoly is a type of market structure that has few companies but with huge capital bases. ‘Few firms’ in this case are taken to mean that the activities of one firm are largely influenced by the activities of the rest of the firms in the industry. In other words, interdependence is eminent. Should one firm, for instance, decide to change the price or make any other fundamental decision, others will follow suit.Advertising We will write a custom research paper sample on Oligopoly specifically for you for only $16.05 $11/page Learn More Such examples would include the print media such as the Newspaper Industry. All companies would decide to charge same prices not because of their individual choices but because of the demands of the market. Readership (sales) in this case will depend on factors other than the price, such as the efficiency of distribution channels (accessibility), quality of the content, subscription and publicity. These facto rs are popular referred to as non- price aspects of competition. Cost Revenue Equilibrium in Oligopoly Any rational firm in an oligopolistic market cannot increase the price above P because it knows very well (perfect knowledge) that it would be pricing itself out of the market, since other firms in the industry will most probably keep their prices stable at P and therefore having a high relative demand. The objective demand is represented by d2. K is not attainable since an increase in price by an individual firm above P will lead to a fall in the quantity demanded, taken from the demand curve D1 K. Again, the price cannot be reduced below P since each firm knows well in advance that any such move would be followed by the rest of the firms in the industry with a view to maintaining their market shares. Thus, the subjective demand Kd1 cannot be individually taken as an advantage because of the tendency for simultaneous pricing decisions. Therefore, there is a high tendency for pric es to remain rigid at P, with the relevant market demand curve being D1 D2 with a kink at point K. The high degree of substitutability of oligopoly products makes the demand for products to be highly price elastic. Oligopoly in the market describes a situation in which firms are price makers. Product differentiation and supernormal profits are earned both in the short run and long run. Because sellers are few, the decisions of sellers are mutually inter-dependent and they cannot ignore each other because the actions of one will affect others (Kreps, 1990).Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Pricing and Output Decisions of the Firm The price and the output shall depend on whether the firm operates in either pure oligopoly or differentiated oligopoly. Oligopoly market normally differentiates its products. But this differentiation might either be weak or strong. Pure olig opoly describes the situation where differentiation of the product is weak. Pricing and output in pure oligopoly can be collusive or non-collusive. Collusive oligopoly refers to a situation where there is co-operation among the sellers that is, co-ordination of prices. Collusion can be Formal or Informal. Formal collusive oligopoly refers to a situation where firms come together to protect their interests for instance, cartels such as OPEC. In this case, members enter into a formal agreement by which the market is shared among them. The single decision maker will set the market price and the quantity offered for sale in the industry. There is a central agency which sets the price. The maximized joint profits are distributed among firms based on an agreed formula. Informal collusive oligopoly can arise mainly because of two reasons. One of them is when the cartel may be weak or unable because of legal requirements or some may be some firms do not want to enter into an agreement or lo se their freedom of action completely. Firms may find it mutually beneficial for them not to engage in price competition. When a cartel does not exist then firms will collude by covert gentlemanly agreement or by spontaneous co-ordination designed to avoid the effects of price war. One such means by which firms can agree is by price leadership. One firm sets the price and others follow with or without understanding (Vives, 1999). When this policy is adopted, firms enter into a tacit market-sharing agreement. Price Leadership There are two types of price leadership. One of them is referred to as the by a low-cost firm pricing model. When there is a conflict of interests among Oligopolists arising from cost differentials, the firms can explicitly or implicitly agree on how to share the market in which the low-cost firm sets the price. We can assume that the low cost firm takes the biggest share of the market. Another price leadership model is referred to as the price leadership by a l arge firm. Some Oligopoly markets consist of one large firm and a number of smaller ones. In this case, the larger firm sets the price and allows the smaller firms to sell at that price and then supplies the rest of the quantity.Advertising We will write a custom research paper sample on Oligopoly specifically for you for only $16.05 $11/page Learn More Each smaller firm behaves as if in a purely competitive market where price is given and each firm sells without affecting the price because each will sell. The formula can be given as follows. MC = P = MR = AR Non-collusive oligopoly on the other hand operates in the absence of collusion and in a situation of great uncertainty. In this case, if one firm raises prices, it is likely to lose a substantial proportion of customers to its rivals. They will not raise the prices because they have the interests of charging a price that is lower than that of their rivals. If the firm lowers the price, it would att ract a large proportion of customers. The other firms are likely to retaliate by lowering their prices, either to the same extent or a large extent. The first firm will retaliate by lowering the price even further. As firms would always expect a counter-strategy from rivals, each firm prices and makes decisions that are tactical. This would then lead to a price war. If it goes on, there would come a time when the prices are so low that if one firm lowers the price, the consumers will see no point in changing from their traditional suppliers. Thus, the demand for the product of the individual firm would start by being elastic and it would end by being inelastic. The demand curve for the product of the individual firm thus consists of two parts, the elastic part and the inelastic part. It is said to be â€Å"kinked’ demand curve, as shown below (Samuelson, Marks 2003). Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More If the firm is on the inelastic part and it raises the price, others will not follow suit. But on this part, prices are so low that it is likely to retain most of its customers. If it raises the prices beyond the kink, it would lose most of its customers to rivals. Hence, the price p will lose most of its customers to rivals. Hence the price p will be the stable price because above it, prices would be unstable. Rising prices means substantial loss of customers and lowering prices may lead to price war. Below p, prices would be considered too low. References Kreps, D. (1990). A Course in Microeconomic Theory. Princeton: Princeton Press. Samuelson, W., Marks, S. (2003). Managerial Economics page (4th ed). New York: Wiley. Vives, X. (1999). Oligopoly pricing. Cambridge, MA: MIT Press. This research paper on Oligopoly was written and submitted by user Bridget Warren to help you with your own studies. You are free to use it for research and reference purposes in order to write your own paper; however, you must cite it accordingly. You can donate your paper here.

Analysis of the Discrimination Against Service Animals essays

Analysis of the Discrimination Against Service Animals essays Service animals perform a wide variety of services and tasks for people with disabilities, and many disabled people would not be able to function effectively without their animals. Initially, service animals were trained to help lead their blind owners through everyday tasks, from walking to work to negotiating around their homes. Called "guide dogs," many were trained by "Seeing Eye," Inc., and those dogs were known as "seeing-eye" dogs. Today, animals, not just dogs, provide a variety of services for the disabled and elderly. Guide dogs still help the blind, and service animals also are trained to help the deaf "hear," and aid wheelchair bound individuals by leading or pulling them, or helping them with balance and movement. They can also pick up and carry items, notify others if their owner is having a seizure, and even act as companions and therapy dogs for people with severe disorders such as autism. One expert writes, "Service dogs perform tasks such as operating light switches, retrieving items, pulling wheelchairs, and opening doors. Hearing dogs assist people who are deaf or hearing impaired by alerting them to sounds such as telephone rings, crying infants, alarms, and people calling them by name" (Henderson). Service animals are not pets, they are highly trained assistants who can make the difference between a disabled person living on their own or living in a group home or other assisted-living situation. Today, they are more than dogs. A variety of animals have been trained to assist the disabled, from miniature horses to pot-bellied pigs and beyond. The use of service animals is not a new idea. One researcher notes, "The use of animals to assist their ailing human counterparts dates to the early Greeks who gave horseback rides to raise the spirits of people who were incurably ill, and documentation from the seventeenth century makes medical reference to h...

How Does AP Credit Work at Colleges

How Does AP Credit Work at Colleges SAT / ACT Prep Online Guides and Tips Whether you already have five AP classes under your belt, or if you’re just considering whether to take AP classes at all, you may be wondering how exactly getting AP college credit works. This article will go over how different colleges grant credit for AP, and what you can do to maximize the amount of AP credit you earn. We will explore some different ways colleges grant AP credit, using specific universities as case studies. Possibility 1: AP Courses Grant Credit for Real College Classes The first way your AP credits could be used is to directly substitute for actual college classes. In this case, instead of taking, say, Chemistry 101, your 4 on AP Chemistry will count for that beginning course. So you’ll get the credit hours for taking the class – even though you took it back in high school! Plus you will be able to enroll in a more difficult course right off the bat. To see what this can look at, let’s look at my local state school, the University of Utah. They accept AP credit for many courses. Case Study: University of Utah AP exams – often with a score of 3 or higher – are enough to grant you credit hours for general education classes at the U of U and also place you into higher level courses. General Education at the University of Utah means any courses that fall in the following categories: Fine Arts, Quantitative Reasoning, Science, Social Science, Humanities, Fine Arts, or American Institutions. If you managed to have an AP class for each one of these general ed requirements, you could skip each one. Since the General Education requirements are designed to fill up the first year, skipping them would make it possible to graduate the University of Utah in just two or three years, depending on what you major in. (A degree in engineering will probably take longer than one in history, for example.) You couldn’t apply, say, both AP English Literature and AP English Language, since they waive the same requirement, but if you submit AP English Literature and AP Calculus AB you would fulfill two different requirements. While these Gen Ed requirements aren’t the same at every university, most universities have some variation of them – at the very least they'll require a course each in humanities, social science, science, and math. This is why taking a variety of AP classes can be helpful if you’re aiming to complete your generals in high school. Also, notice that at the U of U, you can often get more credit hours for 5’s than 3’s and 4s. So even at universities that accept 3s, there are still perks to earning 5s. Possibility 2: AP Courses Don't Get Credit, but Allow You to Skip Intro Courses There are some schools – particularly competitive ones – that don’t give you credit for AP classes. While they will use high scores to place you into higher-level classes freshman year, they won’t give you credit towards graduation. We'll take a look at Dartmouth College to see what this can look like. Case Study: Dartmouth One such school is Dartmouth. You can actually read a statement about their policy on AP credit here. To summarize, Dartmouth will use AP classes to place students in higher-level classes, but not for credit towards graduation. They revised their AP policy because they want students to take full advantage of Dartmouth courses and they’re worried AP courses aren’t true replacements for college level classes. So how does the credit work? To take an example, if you get a 5 on AP Micro Economics, you will be placed in an intermediate or advanced economics course right off the bat, but you won’t receive any credit for AP Micro itself. This can still be helpful if you’re excited to jump into higher classes or want to fit in a minor or double major. You can also be exempted from the foreign language requirement if you score high on an AP language test. So while AP courses won't get you credit at Dartmouth, they are still worthwhile since they will allow you to skip introductory courses. Possibility 3: A Mix of Both Some schools have a mix of both policies. In particular, some departments (say the history department or math department) might accept AP credit to place students in classes. But the school as a whole might have a policy on AP you can choose to take advantage of – for example Harvard’s advanced standing program. Case Study: Harvard So what is advanced standing?Think of it as skipping straight to sophomore year when you start college at Harvard. You can apply for it using your AP credits, and graduate in six or seven semesters instead of eight. You could also just use your AP credits to get into higher-level classes in particular departments or get out of the foreign language requirement, but not apply for advanced standing if you want to stay all four years. So should you apply for advanced standing? Harvard’s website has a lengthy discussion of why or why not a student may apply for it. Some students may prefer to take four years at Harvard undergrad so they don't have to decide their course of study too soon. Taking the full four years gives you more chances to try out classes in various departments. Others may take advantage of advanced standing to earn a masters within four years. In short, if you're lucky enough to go to Harvard, you can decide whether you want to use your AP credits to graduate faster, or if you would rather take four years of undergraduate classes to explore different interests. In either case, you can also use your AP credits to skip introductory courses in various departments. Sending Your Scores Before you can get any AP credit, after you graduate but before you start at your college, you have to send an official AP score report from College Board. While you self-report your AP scores on your college applications, you can only cash in on your AP credits by sending an official score report. This gives the official record of your scores to the registrar’s office. (Think of the registrar as the guidance counseling office of college.) Once the registrar has those scores, they can apply them to pre-requisite, general education, or other departmental requirements as the case may be at your college. Look out for our post on how to send AP scores to colleges if you want a more complete guide. Next Steps If you’re still in high school and wondering how AP credit will work for you, look up the policies at some of your top choices as well as your safeties. Start with College Board’s AP credit database, but also double check college websites to see what they say about AP credit. The database should provide a link to each college’s individual policy, but if not, search â€Å"[Name of College/University] Advanced Placement†. By looking up policies, you can get a sense of how the AP credits you have already earned will translate into college credit. This can also help you choose AP classes for future years. Take notice of AP exams that seem to be recognized at most of the schools you’re interested in. In many cases, AP math courses, particularly Calculus BC, can waive a math requirement or get you into higher level math classes. AP language courses are also often accepted as a way to waive a foreign language requirement. Also notice how high your passing score needs to be (for example, at the U of U, a 3 was fine for many classes, but Harvard only accepts 5s). If most of your schools require 5s to get credit, you have to study very hard! Also look and see if any AP classes you’re thinking about aren’t recognized in any way. Sometimes it can be harder to get credit for courses like Human Geography or Art History. This doesn’t mean to not take them. It does mean that you should only take them if you are really interested in the subject and would get a lot out of the class. What’s Next? How many AP classes should you take, anyway? Get an answer to that question here. AP classes aren’t the only thing that will get you into college – far from it. Your ACT/SAT score is a huge part of your application. Read about the ACT/SAT scores you need to be competitive at your top schools. Not sure when you should take the ACT/SAT for the first time? Find out here. Want to improve your SAT score by 160 points or your ACT score by 4 points?We've written a guide for each test about the top 5 strategies you must be using to have a shot at improving your score. Download it for free now:

Lesson Aids Essay Example | Topics and Well Written Essays - 1000 words

Lesson Aids - Essay Example Each card contains pictures of various servings of food. Five cards consist of the total number of servings from each food group. These cards carry 5 points. 20 cards comprise specific food portions ranging from three servings to one serving. The points attached to these cards range from three to one respectively. There are also three wild cards displaying oil as a food group but students have been taught that oil is not a food group although a small portion is needed to keep one healthy. Therefore anyone picking an oil card will be required to lose a turn for the next round. An oil card may be cancelled when the player gets a card containing the total number of servings from any particular food group (Cancellation of an oil card is the player’s choice). The game begins with each player choosing a card from the 28 stockpile. The player with the highest score on his/her card has the first turn. Each player then picks 5 cards. The first player places one card on the table. In an anti-clockwise manner, the remaining players match the first card using the same food group as displayed on the table ensuring that the recommended daily requirement is not exceeded. The player with the card with the highest points wins that round and ceases the played cards of the opponents. This person plays first in the next round. These ceased cards are put in the player’s basket which would be used to tally the winning score at the end of the game. When a player does not have a card from the food group displayed on the table, he/she is required to take cards from the stock one at a time until a card belonging to that particular food group is obtained. The game ends when either the stock pile is completed or one player has utilized all the cards in his/her hands. The player with the highest points in their basket at the end of the game

What are management techniques. Which ones are effective Research Paper

What are management techniques. Which ones are effective - Research Paper Example The Balanced Scorecard Technique is a performance-based technique that is structured in a way that enables a sequential check and evaluation of processes in order to determine the level of conformity with the expected outcomes (Armstrong 46). The popularity of the Balanced Scorecard has been witnessed largely in western countries. Studies have also found out a significant level of preference of this management tool in Scandinavian countries, the Middle East and Spain. Over the times, theorists and management experts have managed to develop related techniques and concepts of management basing on the structural foundation of the Balanced Scorecard. Some of the related techniques are Results Based Management and the Performance Prism technique. The fundamental feature in these techniques is the linking of all actions towards some specific outcomes. The balanced Scorecard operates through the creation of ‘target values’ that are used to measure the progress and specific outcomes of various processes within the organization. Essentially, the units of measurement are designed in ways that provide the most relevant information about the nature of performance of a given measure. Both financial and non-financial units of performance are assessed against these target values, which act as safeguards to the nature of performance (Armstrong 50). For instance, the volume of sales could be assigned to some specific target value so that all subsequent actions and results regarding the trends of sales are measured against this target value. On this score, it becomes necessary to consider the fact that other matters such as employee performance are regulated and observed through these values. Such measures could involve appraisal processes in which the performance of employees is measured against definite goals in order to deter mine the levels of progress in relation to certain

In the three stories from other cultures (Country Lovers, Veronica and A Stench of Kerosene) Essay Example for Free

In the three stories from other cultures (Country Lovers, Veronica and A Stench of Kerosene) Essay In the three stories from other cultures (Country Lovers, Veronica and A Stench of Kerosene) discuss how the relationships in each one are affected by cultural forces In Country Lovers, the Apartheid in South Africa stopped blacks and whites intermingling. The Apartheid meant that police could decide to invade peoples homes if there was a suspicion of blacks and whites having a sexual relationship together. South Africa was a worse place due to the Apartheid and even now the division still has an affect on peoples lives. The main Act that governed the Apartheid was the Immorality act. This ultimately banned mixed marriages and later went on to be amended to ban sexual relationships. If mixed marriages were heard of the couple would be arrested and sent to prison, although even the sentencing was biased as blacks got harsher sentences than whites. At the start of the story Paulus displayed true love towards Thebedi by bringing home a painted wooden box he had made for her in wood-work classes. He had been sent away to do these classes at a boarding school. The boarding schools were another reason why blacks were not as educated as whites because it was just simply not given to them in the same way it was given to the whites. Thebedi also returned the love by giving Paulus a sort-after bracelet which she had made. This bracelet made his white friends jealous, so this shows that just because Thebedi is black doesnt mean she cannot bring happiness to anyone. This shows the affect it had on both races to the extent where if they had known the bracelet was made by a black person, they wouldnt have been jealous. When Paulus goes off to Veterinary College, it gave Njabulo a chance to show his love for Thebedi. He had had a crush on her for a long time but never revealed his feelings until Paulus went away. The relationship between Thebedi and Njabulo would not have been so frowned upon at all as they were both the same colour. The most controversial issue within the story is when Thebedi and Njabulo supposedly have a baby, but when the baby is born it is mixed-race. Njabulo accepts the baby by going out and buying things for it, he bought from the Indian store a cellophane-widowed pack. This is probably because he loved Thebedi too much to get rid of her because of a mixed-race child. This shows the different views within the cultures. But when Paulus finds out that the baby is most probably his, he demands that Thebedi gets rid of it, You must give it to someone. This shows that he is scared of the authorities, because if they find out he would be facing prison or worse. So when the baby is found dead, and the forensic evidence relates to poison, Paulus is the main suspect. But when Paulus gets to court it says that when Thebedi was giving evidence she was still wearing the ear-rings Paulus had given her when they had first met, she wore gilt-hoop ear-rings. This proved that she still had feelings for Paulus. In Veronica, it is not a case of racial differences; it is the fact that society dictates the way you live by your gender. Fatalism plays a big part in this story. Okeke shows that he accepted what he had been given more so than Veronica. This is shown by the fact that Okeke moves away top the city to try and make a life of his own. Whereas Veronica was not persuaded by Okekes efforts to try and get her to come with him. Instead she stayed in the village to try and scrape a life off of very little money. Okeke proved to be moralistic, all the women I meet are only interested in money and cars. Veronica herself had to mature a lot quicker than any other adolescent as her father was a bitter drunk and her mother was weak and poorly. When Okeke went away to his life in the city, I think both of them were feeling as if their lives were going to be dramatically changed but were too afraid to admit it. Okeke returned to the village as a prosperous doctor with many paths he could choose to take his life down. He came back to discover that Veronica was still living the same life but with a child and husband. Her brothers and sisters that she worked so hard to keep alive had left her and dispersed into different parts of the country and forgotten about her. The war breaks out and Okeke returns again to find Veronica lying there close to death. She says she wants to dies because she has lost everything, I dont want to live, you hear?. So Veronica slips away and Okeke shows how much he felt for her by burying her down by the river, where they spent so much time together in their youth. A Stench of Kerosene is set in Jammu and Kashmir, Northern India. It is based in mid 20th Century. The cultural force that plays its part in this story is the Hindu Marriage Act (1955). This governs all Hindu marriages. This Act also applies to Buddhists and Sikhs. It said that the bride should be 18 and the groom 21. Neither should already have a spouse and both should be capable of giving consent. It was also believed that both spouses should be fit for both marriage and consummation. This rule however did not apply to the counties of Kashmir and Jammu. Manak truly loved his wife called Guleri. There was a carnival in a town called Chamba. Guleri looked forward to it every year and was set on going the same as usual. But there was just one problem, Manak knew that if Guleri left for any length of time, his mother would set up a marriage with someone else he might not even like. He was so seperate for her to stay he even begged her, I ask again, dont go away this time. The reason his mother wanted Manak to get a different was because Guleri had never conceived a child and therefore could not continue with the family name. His mother paid 500 rupees just to get Manak another wife. This worked because after a short time of being with the second wife conceived a child. When Guleri heard the news of Manaks second wife she soaked her clothes in kerosene and set them alight. The fact you dont ever find out what the second wifes name is, tells us that she was irrelevant to Manak and that he considered her to just be there as his wife. The main reason he just put up with her is because he respected his mother and thought that it would be wrong to speak up about how he actually felt. Also this shows that Manaks mother cannot be blamed entirely because she was just acting how her culture dictates. Overall in these didactic stories, it shows the effects that different cultural forces had on peoples relationships and that people had to go to extreme lengths to avoid the terror of being caught doing something they know is wrong but cannot help.

The Unobtainable Good Things in O’Connor’s A Late Encounter with the En

The Unobtainable Good Things in O’Connor’s A Late Encounter with the Enemy I have Seen the Enemy and it is Myself . . . . . . . She wanted the General at her graduation because she wanted to show what she stood for, or, as she said, "what all was behind her," and was not behind them. This them was not anybody in particular. It was just all the upstarts who has turned the world on its head and unsettled the ways of decent living. (134) These are the thoughts of Sally Poker Sash, as offered by Flannery O'Connor in the second paragraph of her story "A Late Encounter with the Enemy." Sally, a sixty-two year old school teacher, is receiving a college degree that has taken her twenty years to earn. She should be proud of her accomplishment. Of course she should be proud. She proves true the old adages, "its never too late" and "good things come to those who wait." Isn't it possible though, that in some situations, the "good things" come too late and when they do arrive they are not so good? I think O'Connor, through this story, is trying to warn us (the readers) of that possibility. The first paragraph of "A Late Encounter" is told from the point-of-view of Sally's grandfather, General Tennessee Flintrock Sash. O'Connor makes it very clear to us that the old man doesn't "give two slaps for her graduation." Surely, his attitude is apparent to Sally, too. Sally is aware of his attitude, too. Why, then, is it so important to her that he live to see her graduation? In the above passage, Sally offers three seemingly simple, but in actuality, complicated explanations for her prayer. Sally states explicitly that she wants her grandfather to attend her graduation because she "wanted to show what she stood for." This is very ... ...tory, opting instead to make for themselves a false past? Ironically, Sally is guilty of using this false past to impress the Dean and guarantee her degree. Graduation day arrives and Sally is ready for the "good thing" that she has waited so long for to arrive. Alas, if it is her grandfather that she wants to prove something to, she is out of luck. O'Conner cheats Sally out of her moment of glory. We learn at the end of the story that the old man dies while on stage at the graduation, oblivious to Sally receiving her diploma. Afterwards, her young nephew, the "crafty scout" John Wesley Poker Sash, hastily bumped the corpse out the back way so that he could get to the Coca-Cola machine; thus depriving Sally of her moment to gloat in front of him. Dammit! Cheated out of triumph again. Sally Sash (whose middle name is after all Poker) had bet on the past and lost.

Lord of the Flies Essay

Essays should be based on a student’s personal experience or observations. The essay should show how a Law of Life applies to a student’s life. Essays that focus on a historical character or that read like a book review are not winning essays. Essays should contain a â€Å"law of life† expressed as a maxim, saying, or quote. (â€Å"Honesty is the best policy† is a Law of Life; the word â€Å"honesty† is not. Essays that do not contain a saying or quote are not eligible to win prizes.) WRITING A GEORGIA LAWS OF LIFE ESSAY Pointers for Students A Law of Life is a wise saying or quote that contains words of truth, lasting meaning, or inspiration. Examples of Laws of Life include: â€Å"An attitude of gratitude creates blessings.† â€Å"You are only as good as your word.† â€Å"To have a friend, be one.† â€Å"Honesty is the best policy.† â€Å"When it is dark enough, you can see the stars.† â€Å"Smile and the world smiles with you.† Think about a personal experience that has taught you about a Law of Life. The experience may have been a major event in your life, or it may have been a small, private moment when you came to understand something profound about life. Perhaps the experience was something traumatic, such as when you or a family member were in a car wreck. Or perhaps the experience was something  that makes you smile every time you think of it – the time your grandmother taught you how to bake a blueberry pie, or the time that you and a friend discovered that laughter was the best medicine. Write an essay that relates your experience to a Law of Life. Be sure to clearly state the Law of Life in your essay! Remember that the best essays include lots of details. These details make the reader feel as though he or she was right there with you when the event occurred. Let the reader know exactly how you felt, and why. Your essay should be between 500 and 700 words. Essays that are shorter or longer than this will be disqualified from the contest. Placing the essay’s word count at the beginning or end of the essay is helpful, but it is not required. Complete the Student Entry Form and staple it to the top of your essay. Make a copy of your essay to keep; the copy that is sent to the Laws of Life Essay Contest will not be returned to you. _ _ _ _ _ _ †Fill your paper with the breathings of your heart.† -William Wordsworth STATE WINNERS $1,000 – First place winner $750 – Second place winner $500 – Third place winner $300 – Fourth place winner $200 – Fifth place winner SCHOOL WINNERS & GRADE WINNERS $100 per School Winner* *School must submit a minimum of 200 essays total for the School Winner to receive a cash award. $50 per Grade Winner* (3 per school)**

Bullying in the organization sby

When we speak of work-place bullying, we are actually referring to the verbal, physical, social or psychological assault that one’s employer or manager, another individual or group of people carry out on a person. In other words it is the tendency of individuals to use increasingly aggressive attitude towards a co-worker or be very unreasonable towards him. This has become an increasingly important problem that Human resource department at most organisations have to counter.What makes workplace bullying far more difficult to counter than school-yard bullying is that it usually operates within the rules and regulations prescribed by the organisation and the society. Also, according to Ichniowski and Olson (2000), workplace bullies generally use words and actions to intimidate their victims, unlike playground bullies, who often resort to using their fists. Workplace bullying may involve verbal, non-verbal abuse tactics, humiliation, physical and psychological aggression.Workplac e bullying isn’t specific to a certain type of work-environment, as it can happen in any type of work condition, ranging from offices to workshops, from highly bureaucratic work environments, like the military, to highly casual ones. Workplace bullying may take different forms such as being rude or confrontational, damaging property that belongs to the organisation, social isolation, screaming and cursing others, physically assaulting them, etc.According to Ichniowski and Olson (2000), psychological and social bullying usually involves verbal abuse, aimed at making fun of one’s work or the individual himself. This may include making fun of one’s ethnicity, family, sexuality, race, education, etc. Isolation is another means of inflicting psychological aggression upon an individual. Workplace bullies will also try various methods of harassment and intimidation to upset your mind and make sure you aren’t able to focus on what you are supposed to, i. e. work. According to Lewis (2003), incase the bully is your boss or employer or supervisor, he or she might try to assign you pointless tasks that have nothing to do with your area of speciality or your job description. The other extreme end would be assigning you jobs that may be extremely boring, difficult or impossible to perform due to lack of time, or deliberately holding back information you need for getting your work done properly. Similarly, one might be a victim of physical bullying, where one may be attacked or threatened.According to Thomas (2005), acts of physical bullying include spitting, pushing, punching, shoving, kicking, tripping, scratching, grabbing, biting, attacking or threatening with equipment such as knives, club, gun, etc or any other type of direct physical contact. Physical bullying also includes sexual harassment, such as flashing or touching, or when you are made to do humiliating things in order to be accepted as part of a team, as stated byIchniowski and Olso n (2000).Incase of physical bullying, especially, one should immediately report the matter to the police and the employer or someone in the human resource department. One can also revert to the following steps in order to deal with a workplace bully, as explained by Ichniowski and Olson (2000): †¢ Seek advice from a trusted individual or may be a mentor, who might be available in the same organisation or even outside, who may have been through a similar situation †¢ One can also try to confront the bully in a professional manner, but keeping in mind one’s own safety and giving it top priority.One should stay as calm as possible, and no sink to his or her level, and yell or threaten, as more often than not this is what bullies are looking for in the first place. And neither should one show weakness and cry, cause that might again motivate the bully to come back for more †¢ One shouldn’t allow the bully to make one feel low self-esteemed, because only the individual would know his or her true worth or capacity †¢ One should focus on the task in hand and try to do it well, because the bully’s goal is most often to try and fail you in your job †¢ One shouldn't let the bully isolate oneself from friends and colleaguesTo date, the phenomenon of workplace bullying is always associated with managers or colleagues who are the perpetrators, but that may not always be the case. There is something known as ‘upward bullying’ which may exist in organisations. In this case managers are actually the target. But since it is very rare, not much research or attention has been given to it. A recent research conducted on upward bullying by students of Griffith University, shows that work environment, change within organizations and power issues are the major contributing factors to upward bullying.According to Kelly (2000), organisations usually do not take workplace bullying by the neck, their policies are usually flawed which enables bullies to take advantage. In most cases the Human Resource Department is aware of who the aggressor is, but they usually wait for something illegal to happen, i. e. if its not illegal harassment there is no effort made to eradicate it. According to Kelly (2000), a research conducted by the University of Illinois indicates that workplace bullying occurs 4 times as frequently as compared to illegal forms of harassment or discrimination.WORKPLACE BULLYING AND THE HUMAN RESOURCE DEPARTMENT However, ideally speaking, an organisation would be better off taking strict action and notice against workplace bullies themselves rather than allowing individuals to do so. The first and foremost step for them would be to come up with an anti-harassment policy, or try to expand an existing anti-harassment policy if it hasn’t proven to be effective enough. Such a policy would also encourage witnesses to come forward and either second the target’s claim or dismiss them.Als o, the human resource department should try to structure a dispute resolution process. This would encourage the targets to step forward sooner. According to Zapf and Einarsen (2001), the human resource department should also monitor the turnover rates and stress-related compensation claims taken by the workers within every department and every manager, so that even if a manager who is guilty of workplace bullying goes unreported, such an analysis ca bring him into the limelight.Another approach to tackling workplace bullying would be to offer courses and training to the supervisors and teach them to criticise employees without offending them. Also, in the present scenario, where, companies, especially the bigger ones have a well-diversified work force, the Human Resource should take claims of workplace bullying very seriously, because if they fail to treat such claims seriously, it would result in further isolation and mistrust on part of the employee.The leadership along with the H uman resource Department should realise the grave consequences workplace bullying may have on the overall efficiency and effectiveness of the organisation. According to Kelly (2000), in approximately 80% of the cases, the employees productivity is adversely affected. This unreasonable behaviour also affects the mental and physical health of the employees, resulting in a decrease in the job satisfaction and job involvement. According to Vartia (1996), it causes a decrease in the employees’ morale, resulting in higher turnover rates.This also causes long term loses to the organisation as they employees that are bullied may sooner or later quit their jobs, this increases the company’s overall advertising expenditure, as they have to advertise frequent job vacancies, and also train the new employee and explain him the job description and the kind of work he would have to perform. Now, the human resource department may respond to issues related to workplace bullying in 5 di fferent ways. The first one is called the Mafioso, which is perhaps the worst stance HR can take with regards to such a situation.In this case even though the HR is aware of the problem and the aggressors, they are not inclined to take any action. In other words they actively participate in bullying employees and support such activities from every possible angle. The second approach is called the Ostrich, where the HR department come up with muffled and sandy responses to reports of workplace bullying, such as saying that, we do not have such problem at the workplace nor are we gong to have one, etc. The third stance is termed as fire-fighter, where the Human Resource Department is overloaded with work, and they do not have time to focus or concentrate on such matters.WORKPLACE BULLYING AND THE LEADERSHIP Apart from the Human resource department itself, leadership of that particular organisation has a very important role to play in managing and curtailing employee behaviour and prev enting workplace bullying. If the leader can take a stand against any such activity, the chances of occurrence may drastically drop automatically. Leaders need to see all employees equally and avoid any biases when treating employees, as stated by Rayner and Cooper (2003). They should prohibit from doing acts that portray favourism towards a particular employee or a group of employees.EMOTIONAL INTELLIGENCE AMONGST INDIVIDUALS Also what might be of significant help when managing workplace bullying in organisations is if the individual has a higher degree of emotional intelligence. It helps employees manage their own mood along with the mood of the organization. It instils in them a greater degree of self-awareness and empathy allowing them to read and regulate their emotions while being able to intuitively grasp how others feel and gauge the emotional state of the organisation. According to Goleman (2000), there are five components to emotional intelligence.Self-awareness is the tra it where emotional intelligence actually begins, such individuals are never hesitant to talk about and discuss their weaknesses and it is this attitude that later brings upon a positive change in them as they are able to improve upon their weaknesses with the passage of time. According to Sheehan (1999), this helps them bring about a positive change as one becomes aware of his or her limitations and one knows when and where he or she can actually stand-up and deliver regardless of the obstacles that may come his way.The second trait is self-regulation, and individuals with this trait can control their emotions and impulses better and channel them for good purposes. This brings about an openness to criticism in their attitude and behaviour, and increases their trustworthiness and integrity, and also helps them remain comfortable in ambiguous and unreasonable situations and scenario, as discussed by Sheehan (1999). So, an individual with higher degree of self-regulation is never intim idated or threatened from workplace bullies, and he never reacts to any of their actions, which is what the bullies ideally want.Motivation is perhaps the most important trait and the most obvious one that an individual is judged upon in an environment where workplace bullying is rampant. The individual needs to self-motivate himself to performing his job and the tasks assigned to him without thinking too much about what activities or attitude other employee or employees have towards him. It portrays the optimism of the individual, and his dedication to the organisation, such that he is able to find positives from every negative thing that happens in his life, so it has to do more with the mind than anything else.Understanding the emotional makeup of others is referred to as empathy. In order to tackle workplace bullying, it is important for the individual to understand why the aggressor is trying to bully him, and what is he trying to achieve from such an act. This can greatly help individual in managing himself and his emotions and react the right way and not lose focus, as explained by Sheehan (1999). The last trait that comes under emotional intelligence is the social skills of the individual.It is the proficiency in managing relationships and building networks that can greatly help an individual to overcome the effects of workplace bullying. It is always a good feeling to have some support on your own side. This may also help in finding common grounds between individuals who are aggrieved and the bullies and it also enables one to build rapport. It also improves his persuasiveness and the ability to build and lead teams. THE CHALLENGE OF CULTURAL CHANGES As described earlier, workplace bullying is a problem that is more common than what people anticipate or realise.It not only impacts the individual himself, but also the organisation and the society itself is affected. And apart from resulting in lost productivity, there are other risks that it bring alon g for the organisation, which include legal expenses and settlement payouts. Many believe that changing the organisation’s culture is the way forward. The challenge for the Human resource department is to picture the prevailing problem of workplace bullying. They also need to identify how much of it is contributed due to the loop holes in the office rules, which describe an employees’ conduct when at work.They also need to identify how much of an impact has training had in shaping their attitude and behaviour. Then comes the most important step, whereby, the human resource department needs to identify practical approaches to nurturing a culture that reduces bullying. Last but not the least, the Human Resource Department needs to identify a long-term approach to tackling such issues, i. e. they need to formulate a long-term strategy to eradicate workplace bullying. References Cooper (eds. ), Bullying and emotional abuse in the workplace.International Perspectives in res earch and practice (London, Taylor and Francis) Cooper, L (eds. ), Bullying and Emotional Abuse in the Workplace. International Perspectives in research and practice (London, Taylor and Francis) Goleman, Daniel. (1998) â€Å"What Makes a Leader? â€Å", Harvard Business Review. Ichniowski, Casey and Craig Olson. (2000). The American Workplace: Skills, Compensation, and Employee Involvement. Cambridge: Cambridge University Press. Kelly, David. (2000). Workplace Bullies Dump Bull on Co-Workers. Available: http://workplacebullying.org/press/hrwire. html. Last accessed 18 September 2008. Lewis, D. (2003), ‘Voices in the social construction of bullying at work’, International Journal of Management and Decision Making, 4, 1. pp. 65-81. Rayner, C. & Cooper, C. L. (2003), ‘The black hole in bullying at work research’, International Journal of Management and Decision Making, 4, 1. Pp. 47-64. Robbins, Stephen P. 2004. Organizational Behavior. New York: Pearsons. Sh eehan, M. (1999), ‘Workplace bullying: responding with some emotional intelligence’, International Journal of Manpower, 20, ?, pp 57-69 Thomas M. (2005), ‘Bullying among support staff in a higher education institution’, Health Education, 105, 4, pp. 273-288. Vartia, M. (1996), ‘The sources of bullying – psychological work environment and organisational climate’, European Journal of Work and Organisational Psychology, 5, 2. pp 203-214. Zapf, D. & Einarsen, S. (2001), ‘Bullying in the workplace: Recent trends in research and practice – an introduction’, European Journal of Work and Organisational Psychology, 10 (4), pp. 369-373.

Top 3 Time Management Tools to Meet Deadlines for Your College Assignment

Top 3 Time Management Tools to Meet Deadlines for Your College Assignment Top 3 Time Management Tools to Meet Deadlines for Your College Assignment College life can be incredibly stressful for many students if they are not organized properly. Every individual is different while some live without noticing how time runs fast, others can’t realize how to succeed in performing all the task from a schedule. According to the study â€Å"The Impact of Time Management on the Students’ Academic Achievements†, time management is highly related to the student’s academic performance. So, the ability to effectively budget and manage time will have a positive impact on your student life and not only. The time management skill is especially important to ensure that you complete all your assignments in due time. How to Develop Time Management Skills? Being a student, you should understand that every assignment is important and failing to deliver a top-quality one on time can play a cruel joke with you. There is a big difference between focusing on schedule and being forced to finish the entire year of education. Furthermore, good skills at managing time can help you avoid unnecessary stress. You’ll be able to free up time for extracurricular activities. Granted, not everyone is good at efficient time management but there are ways to improve and make time for the studies and relax. 1.   Create a Schedule and Stick to It One of the easiest ways to ensure that you manage your time effectively is to create a daily schedule for yourself. While you are creating your schedule, you can determine what activities are a top priority and what activities are not so important. By doing so, you can ensure that you leave enough time on planning, research, writing and reviewing your assignments before the deadlines. For this purpose, use the following online app: Google Calendar. It is an online platform where you can create your schedule for the studies at university or college. Set time for particular tasks and this app will remind you what you should do in the nearest time. 2.   Use a Time Tracker Experienced the situation when you planned to spend 20 minutes on a task but finally spent an hour? It is a common practice among students. It’s one of the challenges to stick to schedule time. It happens only because of the lack of an instrument that you would use to measure time. You’re lucky to be focused on time with the help of: Tomighty. It is a timer that can help you be focused on a task and meet its deadline. Make an oath to finish, for example, in 30 minutes. Plunge into an assignment until the timer rings. It allows you to rest at the same time by taking little breaks as well. 3.   Block Yourself from Different Distractions Look around yourself to see what takes your attention. Is it a social media site that you check many times while working on an assignment? Thus, it‘s time to take control of your success by means of: Stay Focused. It is a block application that allows to reduce the daily usage of distracting websites. It is much better to keep focused on the brilliant academic performance than to waste time on social networking or messaging. Later, after you finish a task, feel free to communicate with pen-friends at your leisure. Identifying useful tools and resources can help you better manage your time, whether you are a part-time student or a full-time freshman. Avoid missing important deadlines. The most important tip to keep in mind is to always list your assignments in order of priority. The sooner you complete the task, the lower your stress levels will be. Learn not to put off your assignments until the last minute even if they are small. Even if you feel you don’t manage to submit a paper on time, don’t worry. Our certified specialists in custom assignment writing are able to boost your final score within the shortest deadline.

Word Choice Compliment vs. Complement

Word Choice Compliment vs. Complement Word Choice: Compliment vs. Complement Tom Selleck has beautiful eyes. We know that’s a little weird for an opening sentence in a proofreading blogpost, but we needed to illustrate what a â€Å"compliment† is. And partly we’re hoping Tom Selleck googles himself and reads this. We love Tom Selleck. Just look at that gorgeous specimen. Anyway, back to work. Today we’re discussing the difference between â€Å"compliment† and â€Å"complement.† Given their similarity in spelling and pronunciation, it’s understandable that these terms are confused sometimes. Yet each word has a distinct meaning, so it’s important to use them properly in your written work. Compliment/Complimentary As indicated above, a â€Å"compliment† is an expression of praise or approval: When I met Tom Selleck, I complimented him on his bushy mustache. He shampoos it every day. [Photo: Alan Light]This sense of â€Å"compliment† can be used either as a noun when referring to the praise itself, or as a verb when referring to the act of expressing praise. Meanwhile, the adjective â€Å"complimentary† has two meanings. One is to describe something or someone as having expressed admiration: After we were done talking, Tom Selleck thanked me for being complimentary. The other is to describe something as having been provided without charge or as a courtesy: I offered Tom Selleck the complimentary chocolate from my hotel room, but he declined. Complement/Complementary The verb â€Å"complement† means to â€Å"add to† or â€Å"enhance† something by making it more complete or effective: Tom Selleck’s sunglasses perfectly complement his Hawaiian shirt. Something which â€Å"complements† something else in this way can be described as a â€Å"complement.† Sometimes â€Å"complement† is also used as a noun meaning â€Å"the number of something required for a full set†: I wanted to go to Tom Selleck’s party, but he said they had a full complement of guests. The adjective â€Å"complementary† has the sense of â€Å"adding to† or â€Å"enhancing† something, and is used when describing two things that are useful or attractive together: The complementary combination of good looks and charisma made Tom Selleck one of the most popular TV actors of the 1980s. Also, he was in Three Men and a Baby. [Photo: Georges Biard] Compliment or Complement? Whether or not you’re intending to praise Tom Selleck, it’s essential to know the difference between â€Å"compliment† and â€Å"complement.† Remember: Compliment = Praise Complement = Add to/make complete The exception here is when â€Å"complimentary† means â€Å"free† or â€Å"as a courtesy,† as this isn’t directly related to praise. But as long as you can remember this general rule, you should be able to avoid confusions in your written work.

Marketing the Fashion Product Essay Example | Topics and Well Written Essays - 3000 words

Marketing the Fashion Product - Essay Example The essay "Marketing the Fashion Product" talks about the successful marketing strategy of the biggest clothes retailer in the United Kingdom Marks and Spencer (M&S). The lingerie market has grown steadily over the past decades with the United Kingdom experiencing consistent growth. M&S have grown consistently with new designs, innovative practices to record huge volume of sales in the last 5 years. â€Å"The total UK lingerie market was worth an estimated  £2.93bn in 2010, increasing by 17.8% over the 5-year review period.† M&S underwear brands consist of ‘Autograph’, ‘Per Una’ and ‘M&S Woman’ for women. For men it is ‘Autograph underwear’, ‘collezione’. Marketing has always been the nucleus of any business. There is no other alternative to reach the customers than a proper marketing plan and execution. The companies need to reach out to the customers and offer them the best services and quality at competitive prices. It is not necessary for M&S to provide cheap products as quality is the key to the underwear market segment where comfort counts. The twofold goal of marketing is to attract new customers by promising superior value and to keep and grow current customers by delivering satisfaction. The 7P marketing mix is a scientific account of the key areas of marketing which are Product, Price, place, promotion, packaging, positioning, and people. The idea of marketing mix is the same idea as mixing a cake. A baker will alter the proportions of ingredients in a cake depending on the type of cake he/she wishes to bake. The proportions in marketing mix can be altered in the same way and can differ from product to product.† (GCSE,2001) Product selling is a critical area where the customer habits and trends decide whether they want to purchase the product. Quality and innovative design are key factors where the marketers need to equip themselves with answers to critical questions as to the marketability and the acceptability of a product. Product demand and the trend of the market will decide on the sale of the product. M&S have the uniqueness in them where their innovative designers are constantly researching on the aspect of giving the customer an out of the box design. The body shape wear designed by their experts were special for the customers where they welcomed it and very soon it became the trend setter for the underwear brands. Apart from the core product selling, after sales services are also an important segment of product selling as it gives an element of trust to the company. Price is the second P of the

Executive ethics Research Paper Example | Topics and Well Written Essays - 1250 words

Executive ethics - Research Paper Example His executive roles in terms of ethical interpretation seem to have a rare following with a mixture of reactions that have apparently been masked by the success that the corporation has made. In tracing Zuckerberg’s track record as an ethical CEO, this discourse displays the two sides of the youthful Facebook icon. This section deals with a description of his ethical beliefs and practices at the helm of the leading social network. At Facebook, the corporation picture of professionalism is boosted by the founder’s belief that amassing the best professionally capable human resource will salvage the chances of operations. According to the executive approach that the CEO has adopted over the years, a very stable team of managers can only enable the corporation to rise from strength to strength. This is evidenced by the choice of his vice president and other top managers who have a rich history in dealing with corporate affairs. In view of the implication that the choices of the management team that Zuckerberg chose, we can draw an inference that he prefers professionalism in handling of corporate management at Facebook. The fortunes of the company on a backdrop of controversies illustrate an internal strength that professionalism accords Facebook. Under Zuckerberg’s tenure, Facebook’s corporate responsibility has evolved to keep in touch with the changing business environment. By facilitating one of the most time-progressive policies which acknowledges keeping up with the pace of environmental issues, Zuckerberg paints an image of a CEO who is conscious of ethical principle of corporate social responsibility. Facebook does not only lead in the pack for the campaign to promote climate change responsive agenda, it actually implements on of the most progressive green energy projects at its server facilities. Such community minded leadership is only made fruitful by the contributions of a youthful CEO under the guidance of some ethical principles. In a

Cause and Prevention of Type2 Diabetes in Urban China Essay

Cause and Prevention of Type2 Diabetes in Urban China - Essay Example Rapid economic growth after reformation has lead to lifestyle changes in China's population. Reduced physical activity and unhealthy eating habits inevitably lead to obesity and diabetes, and in fact such lifestyle changes have led to rapid increase in the incidence of Type2 diabetes in urban China. Furthermore, China has now overtaken India as the country with the largest number of diabetes patients in the world, with 50 million patients currently, and an annual incremental rate of 1-2 million. It is predicted that 100 million of China's 1.3 billion people will have diabetes by 2025. In urban regions of China, around 50% of Type2 patients are children. Type2 diabetes in children is easily overlooked, and delays in treatment can have serious consequences. Hence, medical experts warn that vigilance is essential to prevent and treat the disease in children. Lifestyle intervention will play an important role in diabetes management, particularly because insulin injections are too expensi ve for the majority of Chinese. First, a systematic review of existing literature will consider information about the following: causes of Type2 diabetes, medical treatments (effectiveness, cost and benefit), and lifestyle intervention approaches (effectiveness, cost and benefit). Following this, a number of methods will be used to gather and evaluate relevant data. Using the deductive approach will require starting with a general hypothesis; for example, "lifestyle changes are directly increasing incidence of Type2 diabetes and prevention strategies should be implemented". Inductive research, on the other hand, will allow the researcher to account for the possibility that there may be less obvious influences on the rising frequency of Type2 diabetes in China. A mixture of research strategies designed to obtain qualitative and quantitative data, such as questionnaires and interviews, will be applied on selected groups of diabetics, medical staff, schools, doctors and hospitals. Surveys and questionnaires will gather data used in the deductive approach, while interviews will gather qualitative data for an inductive approach. Various research methods used together will help cancel out the 'method effect'. (Smith 1975) Face-to-face interviews are essential to this research topic, and gaining qualitative data is the primary focus. Economic evaluation will involve a comparison of the costs and benefits of treatment versus prevention strategies. It is suggested that such a comparison will show that it is far more beneficial from an economic standpoint to prevent diabetes rather than to treat it. Feasibility Primary data will be obtained from publications by the World Health Organisation, China's Ministry of Health, and Official Chinese News Agents. A systematic

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.