Cause and Prevention of Type2 Diabetes in Urban China Essay

Cause and Prevention of Type2 Diabetes in Urban China - Essay Example Rapid economic growth after reformation has lead to lifestyle changes in China's population. Reduced physical activity and unhealthy eating habits inevitably lead to obesity and diabetes, and in fact such lifestyle changes have led to rapid increase in the incidence of Type2 diabetes in urban China. Furthermore, China has now overtaken India as the country with the largest number of diabetes patients in the world, with 50 million patients currently, and an annual incremental rate of 1-2 million. It is predicted that 100 million of China's 1.3 billion people will have diabetes by 2025. In urban regions of China, around 50% of Type2 patients are children. Type2 diabetes in children is easily overlooked, and delays in treatment can have serious consequences. Hence, medical experts warn that vigilance is essential to prevent and treat the disease in children. Lifestyle intervention will play an important role in diabetes management, particularly because insulin injections are too expensi ve for the majority of Chinese. First, a systematic review of existing literature will consider information about the following: causes of Type2 diabetes, medical treatments (effectiveness, cost and benefit), and lifestyle intervention approaches (effectiveness, cost and benefit). Following this, a number of methods will be used to gather and evaluate relevant data. Using the deductive approach will require starting with a general hypothesis; for example, "lifestyle changes are directly increasing incidence of Type2 diabetes and prevention strategies should be implemented". Inductive research, on the other hand, will allow the researcher to account for the possibility that there may be less obvious influences on the rising frequency of Type2 diabetes in China. A mixture of research strategies designed to obtain qualitative and quantitative data, such as questionnaires and interviews, will be applied on selected groups of diabetics, medical staff, schools, doctors and hospitals. Surveys and questionnaires will gather data used in the deductive approach, while interviews will gather qualitative data for an inductive approach. Various research methods used together will help cancel out the 'method effect'. (Smith 1975) Face-to-face interviews are essential to this research topic, and gaining qualitative data is the primary focus. Economic evaluation will involve a comparison of the costs and benefits of treatment versus prevention strategies. It is suggested that such a comparison will show that it is far more beneficial from an economic standpoint to prevent diabetes rather than to treat it. Feasibility Primary data will be obtained from publications by the World Health Organisation, China's Ministry of Health, and Official Chinese News Agents. A systematic

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.

Role of Women in Othello Essay -- Othello essays

Role of Women in Othello  Ã‚        Ã‚  Ã‚   In William Shakespeare’s tragic drama Othello, the wife of the protagonist, Desdemona, is the main female character. Secondly, there is the ancient’s wife, Emilia, who is morally ambivalent. Thirdly, there is the girlfriend of Michael Cassio, Bianca, who makes her appearance later in the drama. This essay will analyze the roles of these three women.    At the outset of the play Iago persuades the rejected suitor of Desdemona, Roderigo, to accompany him to the home of Brabantio, Desdemona’s father, in the middle of the night. Once there the two awaken the senator with loud shouts about his daughter’s elopement with Othello. This is the initial reference to the role of women in the play – the role of wife. In response to the noise and Iago’s vulgar descriptions of Desdemona’s involvement with the general, Brabantio arises from bed. Iago’s bawdy references to the senator’s daughter present a second role of women – that of illicit lover. With Roderigo’s help, he gathers a search party to go and find Desdemona and bring her home. The father’s attitude is that life without his Desdemona will be much worse than before:    It is too true an evil: gone she is;   Ã‚  Ã‚  Ã‚   And what's to come of my despised time   Ã‚  Ã‚  Ã‚   Is nought but bitterness. (1.1)    Here is seen another role or function of women in the drama – that of comforter for the aged. Brabantio is the old father, and he hates to lose the comforting services of his Desdemona. The daughter’s husband Othello expresses his sentiments to Iago regarding his relationship with the senator’s daughter, saying    that I love the gentle Desdemona,   Ã‚  Ã‚  Ã‚   I would not my unhoused free condition   Ã‚  Ã‚  Ã‚   Put into circumscriptio... ...y true!† and accuses him of lying:      Ã‚  Ã‚  Ã‚   You told a lie, an odious, damned lie;   Ã‚  Ã‚  Ã‚   Upon my soul, a lie, a wicked lie.   Ã‚  Ã‚  Ã‚   She false with Cassio! (5.2)    Then she accuses him of causing murder: â€Å"And your reports have set the murder on.† Emilia’s stunning interrogation and conviction of her own husband as the evil mastermind behind the crime results in Iago’s killing her. Despondent Othello, grief-stricken by remorse for the tragic mistake he has made, stabs himself and dies on the bed next to his wife.    Thus it is seen that the roles of women are many and varied – and are key to the successful development of the story.    WORKS CITED    Shakespeare, William. Othello. In The Electric Shakespeare. Princeton University. 1996. http://www.eiu.edu/~multilit/studyabroad/othello/othello_all.html No line nos.         

Ensuring People Support for Education and Training Programs Essay

A collaborative effort is a key to success in the field of continuing education.   That is to maintain partnership with the learners, the supervisors and, the managers.   To ensure support from each participant it is important that there is connectivity before, during, and after the training program.   After all, learning is effective when it is applied as well as teaching is assimilated when it is explained. In Cafarella’s book, the five primary purpose of education was explicitly stated that is; â€Å"to encourage growth, to assist with practical problems, to prepare people for current and future opportunities, to assist with change for desired results, and to examine community or social issues (Schultz, 2002).†   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Educators are tasked to elaborate from the beginning the reason of the training program and if it is presented to learners as useful and not mandatory support from the learner is ensured even from the start of the program.   Key people or the supervisors can be invited in the planning process so that they can tell the planner or the educator actual experiences on how the knowledge will be applied.   Also it is best to include the supervisors in giving decisions on when is the training program be scheduled so that critical schedule in their operations will not be hampered.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   During trainings learners should get involved in the discussion by inviting them to give examples and with those actual situations mentioned by the participants, trainers should help the learner to reflect on the subject and how it could be applied.   Supervisors at the same time can be asked to mentor or assist in the on-going program.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Training program does not end at the venue but probing whether the learning process is blocked after instruction was given ensures effectiveness of the course.   Learners should be encouraged to help one another and evaluate the learning process.   Supervisors should be asked on the feedback if the course has been effective by checking if what is learned was applied in each participants actual work situation.   To ensure continuous support and partnership, endings should be addressed whether it is positive or negative (Caffarella, 2002).   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Managers are tasked to implement goals and objectives; they are the one who manage change.   To ensure their support from beginning to end, they should be asked to provide consultations before and after.   They should be convinced that the program is helping their organization to grow. References Schultz, J. D. (2002). Book Review: Planning Programs for Adult Learners, 2nd Edition by Rosemary A. Caffarella [Electronic Version]. Retrieved 12 February 2008 from http://www.exchangesjournal.org/reviews/review_1107.html. Caffarella, R.A. (2002).   Planning Programs for Adult Learners (Chapter 5), 2nd Edition, 403 pages ISBN: 0-7879-5225-7.

A Clean and Well-Lighted Place

â€Å"A Clean and Well-Lighted Place† Analysis Does one's purpose in life diminish after there is nothing left in life to look forward to? In Ernest Hemingway’s short story, â€Å"A Clean and Well-Lighted Place,† this question is addressed in terms of the four main themes of existentialism: existence precedes essence, absurdity, anxiety or angst, and nothingness. The author does this by creating a story in which all of these themes are featured individually.Existentialism is â€Å"a philosophy that emphasizes the uniqueness and isolation of the individual experience in a hostile or indifferent universe, regards human existence as unexplainable, and stresses freedom of choice and responsibility for the consequences of one’s acts. † The most prominent theme of existentialism is that of nothingness. This is featured in the story through the old waiter when he comes to the conclusion that without motivation to live, one wanders in a world of nothingness . This story highlights issues like depression, isolation, aging and anguish, but are all centered on the theme of existentialism.One of the themes of existentialism is, existence precedes essence. In other words, an independently acting and responsible conscious person is more important than the labels, and stereotypes that the individual falls under. This can be found within the first interaction in the story, between the two waiters. They are talking about the old man that is perpetually drinking his life away. The young waiter is judging the old man based on how much money he has, how old he is, and that he is deaf. The young waiter is unable to understand why he should try to kill himself, when he has money.However, the old waiter is constantly defending the old man like, â€Å"‘Not always, This old man is clean. He drinks without spilling. Even now, drunk. Look at him. ’† The old waiter is focusing more on how the old man conducts himself, rather than looki ng at his features, and income to judge him. The next theme of existentialism is that of anxiety or angst. This is a feeling of dread, which is not directed to an object, but of the nothingness of human existence. A person that cannot find their purpose in life or is unable to define themselves would feel this dread.This pertains to the story, because this is what the old man drinking at the cafe is feeling. The first example of this is the soldier that is mentioned. He doesn’t recognize nothingness, rather he tries to find something that gives his life purpose, like joining the service. But, he is still left with a sense of nothingness, so he tries to find meaning in the act of sexual gratification. In the opening lines of the story, the two waiters discuss how the old man tried to kill himself. When asked why he tried to commit suicide, one waiter replied, â€Å"‘He was in despair’ ‘What about? ‘Nothing. ’† The old waiter understands w hy this old man tried to commit suicide. The theme of anxiety can be applied to another part of this story, and that is why the old man chose to stay at the cafe and not go home and drink out of a bottle. The clean and bright cafes are the only reason that the old man is able to get through the night, without collapsing into despair. Absurdity is the idea that there is no meaning to life outside of the meaning that an individual gives it. Blaise Pascal, a French mathematician and philosopher states, When I consider the short duration of my life, swallowed up in the eternity before and after, and the little space I fill, and even can see, engulfed in the infinite immensity of space of which I am ignorant, and which knows me not, I am frightened, and am astonished at being here rather than there, why now rather than then† (Gormley 1). This theme can be seen in the story from the conversations between the two waiters. To the young waiter money and material satisfaction is everyth ing. The young waiter is also portrayed as in a constant hurry.He wants to be home with his wife, while the old waiter is content to sit in the cafe. The old waiter believes life to be absurd, and his short time on earth isn’t going to alter anyone’s life. The final theme of existentialism is the idea of nothingness. For many existentialists religion is absurd, because these religions fail to reflect existence. They are in fact part of someone’s essence, because people can be classified as a Christian or a Jew. This idea is bleak, and suggests that there is nothing but a void after death. This is part of the reason that many existentialists suffer from depression and insomnia.The understanding there is nothing structuring one’s world, it becomes very daunting. This is the reason that the old man and old waiter search for refuge in a well-lighted place, because for people like themselves, this is the only escape from the lonely and dark night. When the old waiter starts to recite the Lord’s prayer, he replaces most of the nouns with â€Å"nada,† or â€Å"nothing† in Spanish, this reflects the atheist view that many existentialists share. They believe that there is nothing after death, but only a void. Understanding that Hemingway actually ended his own life gives this story another meaning.In the final part of this story, the old man gives up his search of his own clean and well-lighted place, and resigns to go home and lie in his bed. He admits he suffers from insomnia, and justifies it to himself by stating, â€Å"Many must have it. † This could be Hemingway’s way of showing pity to his readers who, like him, cannot bear the emptiness. Hemingway gives the reader the bare minimum of information, leaving the reader no way to understand â€Å"nada† and existential depression. However, he offers the reader an escape from this pain of â€Å"nada. † In order to survive with dignity, one ha s to find a â€Å"clean and well-lighted† place of their own.