Sunday, November 10, 2019

Bullying in the organization sby

When we speak of work-place bullying, we are actually referring to the verbal, physical, social or psychological assault that one’s employer or manager, another individual or group of people carry out on a person. In other words it is the tendency of individuals to use increasingly aggressive attitude towards a co-worker or be very unreasonable towards him. This has become an increasingly important problem that Human resource department at most organisations have to counter.What makes workplace bullying far more difficult to counter than school-yard bullying is that it usually operates within the rules and regulations prescribed by the organisation and the society. Also, according to Ichniowski and Olson (2000), workplace bullies generally use words and actions to intimidate their victims, unlike playground bullies, who often resort to using their fists. Workplace bullying may involve verbal, non-verbal abuse tactics, humiliation, physical and psychological aggression.Workplac e bullying isn’t specific to a certain type of work-environment, as it can happen in any type of work condition, ranging from offices to workshops, from highly bureaucratic work environments, like the military, to highly casual ones. Workplace bullying may take different forms such as being rude or confrontational, damaging property that belongs to the organisation, social isolation, screaming and cursing others, physically assaulting them, etc.According to Ichniowski and Olson (2000), psychological and social bullying usually involves verbal abuse, aimed at making fun of one’s work or the individual himself. This may include making fun of one’s ethnicity, family, sexuality, race, education, etc. Isolation is another means of inflicting psychological aggression upon an individual. Workplace bullies will also try various methods of harassment and intimidation to upset your mind and make sure you aren’t able to focus on what you are supposed to, i. e. work. According to Lewis (2003), incase the bully is your boss or employer or supervisor, he or she might try to assign you pointless tasks that have nothing to do with your area of speciality or your job description. The other extreme end would be assigning you jobs that may be extremely boring, difficult or impossible to perform due to lack of time, or deliberately holding back information you need for getting your work done properly. Similarly, one might be a victim of physical bullying, where one may be attacked or threatened.According to Thomas (2005), acts of physical bullying include spitting, pushing, punching, shoving, kicking, tripping, scratching, grabbing, biting, attacking or threatening with equipment such as knives, club, gun, etc or any other type of direct physical contact. Physical bullying also includes sexual harassment, such as flashing or touching, or when you are made to do humiliating things in order to be accepted as part of a team, as stated byIchniowski and Olso n (2000).Incase of physical bullying, especially, one should immediately report the matter to the police and the employer or someone in the human resource department. One can also revert to the following steps in order to deal with a workplace bully, as explained by Ichniowski and Olson (2000): †¢ Seek advice from a trusted individual or may be a mentor, who might be available in the same organisation or even outside, who may have been through a similar situation †¢ One can also try to confront the bully in a professional manner, but keeping in mind one’s own safety and giving it top priority.One should stay as calm as possible, and no sink to his or her level, and yell or threaten, as more often than not this is what bullies are looking for in the first place. And neither should one show weakness and cry, cause that might again motivate the bully to come back for more †¢ One shouldn’t allow the bully to make one feel low self-esteemed, because only the individual would know his or her true worth or capacity †¢ One should focus on the task in hand and try to do it well, because the bully’s goal is most often to try and fail you in your job †¢ One shouldn't let the bully isolate oneself from friends and colleaguesTo date, the phenomenon of workplace bullying is always associated with managers or colleagues who are the perpetrators, but that may not always be the case. There is something known as ‘upward bullying’ which may exist in organisations. In this case managers are actually the target. But since it is very rare, not much research or attention has been given to it. A recent research conducted on upward bullying by students of Griffith University, shows that work environment, change within organizations and power issues are the major contributing factors to upward bullying.According to Kelly (2000), organisations usually do not take workplace bullying by the neck, their policies are usually flawed which enables bullies to take advantage. In most cases the Human Resource Department is aware of who the aggressor is, but they usually wait for something illegal to happen, i. e. if its not illegal harassment there is no effort made to eradicate it. According to Kelly (2000), a research conducted by the University of Illinois indicates that workplace bullying occurs 4 times as frequently as compared to illegal forms of harassment or discrimination.WORKPLACE BULLYING AND THE HUMAN RESOURCE DEPARTMENT However, ideally speaking, an organisation would be better off taking strict action and notice against workplace bullies themselves rather than allowing individuals to do so. The first and foremost step for them would be to come up with an anti-harassment policy, or try to expand an existing anti-harassment policy if it hasn’t proven to be effective enough. Such a policy would also encourage witnesses to come forward and either second the target’s claim or dismiss them.Als o, the human resource department should try to structure a dispute resolution process. This would encourage the targets to step forward sooner. According to Zapf and Einarsen (2001), the human resource department should also monitor the turnover rates and stress-related compensation claims taken by the workers within every department and every manager, so that even if a manager who is guilty of workplace bullying goes unreported, such an analysis ca bring him into the limelight.Another approach to tackling workplace bullying would be to offer courses and training to the supervisors and teach them to criticise employees without offending them. Also, in the present scenario, where, companies, especially the bigger ones have a well-diversified work force, the Human Resource should take claims of workplace bullying very seriously, because if they fail to treat such claims seriously, it would result in further isolation and mistrust on part of the employee.The leadership along with the H uman resource Department should realise the grave consequences workplace bullying may have on the overall efficiency and effectiveness of the organisation. According to Kelly (2000), in approximately 80% of the cases, the employees productivity is adversely affected. This unreasonable behaviour also affects the mental and physical health of the employees, resulting in a decrease in the job satisfaction and job involvement. According to Vartia (1996), it causes a decrease in the employees’ morale, resulting in higher turnover rates.This also causes long term loses to the organisation as they employees that are bullied may sooner or later quit their jobs, this increases the company’s overall advertising expenditure, as they have to advertise frequent job vacancies, and also train the new employee and explain him the job description and the kind of work he would have to perform. Now, the human resource department may respond to issues related to workplace bullying in 5 di fferent ways. The first one is called the Mafioso, which is perhaps the worst stance HR can take with regards to such a situation.In this case even though the HR is aware of the problem and the aggressors, they are not inclined to take any action. In other words they actively participate in bullying employees and support such activities from every possible angle. The second approach is called the Ostrich, where the HR department come up with muffled and sandy responses to reports of workplace bullying, such as saying that, we do not have such problem at the workplace nor are we gong to have one, etc. The third stance is termed as fire-fighter, where the Human Resource Department is overloaded with work, and they do not have time to focus or concentrate on such matters.WORKPLACE BULLYING AND THE LEADERSHIP Apart from the Human resource department itself, leadership of that particular organisation has a very important role to play in managing and curtailing employee behaviour and prev enting workplace bullying. If the leader can take a stand against any such activity, the chances of occurrence may drastically drop automatically. Leaders need to see all employees equally and avoid any biases when treating employees, as stated by Rayner and Cooper (2003). They should prohibit from doing acts that portray favourism towards a particular employee or a group of employees.EMOTIONAL INTELLIGENCE AMONGST INDIVIDUALS Also what might be of significant help when managing workplace bullying in organisations is if the individual has a higher degree of emotional intelligence. It helps employees manage their own mood along with the mood of the organization. It instils in them a greater degree of self-awareness and empathy allowing them to read and regulate their emotions while being able to intuitively grasp how others feel and gauge the emotional state of the organisation. According to Goleman (2000), there are five components to emotional intelligence.Self-awareness is the tra it where emotional intelligence actually begins, such individuals are never hesitant to talk about and discuss their weaknesses and it is this attitude that later brings upon a positive change in them as they are able to improve upon their weaknesses with the passage of time. According to Sheehan (1999), this helps them bring about a positive change as one becomes aware of his or her limitations and one knows when and where he or she can actually stand-up and deliver regardless of the obstacles that may come his way.The second trait is self-regulation, and individuals with this trait can control their emotions and impulses better and channel them for good purposes. This brings about an openness to criticism in their attitude and behaviour, and increases their trustworthiness and integrity, and also helps them remain comfortable in ambiguous and unreasonable situations and scenario, as discussed by Sheehan (1999). So, an individual with higher degree of self-regulation is never intim idated or threatened from workplace bullies, and he never reacts to any of their actions, which is what the bullies ideally want.Motivation is perhaps the most important trait and the most obvious one that an individual is judged upon in an environment where workplace bullying is rampant. The individual needs to self-motivate himself to performing his job and the tasks assigned to him without thinking too much about what activities or attitude other employee or employees have towards him. It portrays the optimism of the individual, and his dedication to the organisation, such that he is able to find positives from every negative thing that happens in his life, so it has to do more with the mind than anything else.Understanding the emotional makeup of others is referred to as empathy. In order to tackle workplace bullying, it is important for the individual to understand why the aggressor is trying to bully him, and what is he trying to achieve from such an act. This can greatly help individual in managing himself and his emotions and react the right way and not lose focus, as explained by Sheehan (1999). The last trait that comes under emotional intelligence is the social skills of the individual.It is the proficiency in managing relationships and building networks that can greatly help an individual to overcome the effects of workplace bullying. It is always a good feeling to have some support on your own side. This may also help in finding common grounds between individuals who are aggrieved and the bullies and it also enables one to build rapport. It also improves his persuasiveness and the ability to build and lead teams. THE CHALLENGE OF CULTURAL CHANGES As described earlier, workplace bullying is a problem that is more common than what people anticipate or realise.It not only impacts the individual himself, but also the organisation and the society itself is affected. And apart from resulting in lost productivity, there are other risks that it bring alon g for the organisation, which include legal expenses and settlement payouts. Many believe that changing the organisation’s culture is the way forward. The challenge for the Human resource department is to picture the prevailing problem of workplace bullying. They also need to identify how much of it is contributed due to the loop holes in the office rules, which describe an employees’ conduct when at work.They also need to identify how much of an impact has training had in shaping their attitude and behaviour. Then comes the most important step, whereby, the human resource department needs to identify practical approaches to nurturing a culture that reduces bullying. Last but not the least, the Human Resource Department needs to identify a long-term approach to tackling such issues, i. e. they need to formulate a long-term strategy to eradicate workplace bullying. References Cooper (eds. ), Bullying and emotional abuse in the workplace.International Perspectives in res earch and practice (London, Taylor and Francis) Cooper, L (eds. ), Bullying and Emotional Abuse in the Workplace. International Perspectives in research and practice (London, Taylor and Francis) Goleman, Daniel. (1998) â€Å"What Makes a Leader? â€Å", Harvard Business Review. Ichniowski, Casey and Craig Olson. (2000). The American Workplace: Skills, Compensation, and Employee Involvement. Cambridge: Cambridge University Press. Kelly, David. (2000). Workplace Bullies Dump Bull on Co-Workers. Available: http://workplacebullying.org/press/hrwire. html. Last accessed 18 September 2008. Lewis, D. (2003), ‘Voices in the social construction of bullying at work’, International Journal of Management and Decision Making, 4, 1. pp. 65-81. Rayner, C. & Cooper, C. L. (2003), ‘The black hole in bullying at work research’, International Journal of Management and Decision Making, 4, 1. Pp. 47-64. Robbins, Stephen P. 2004. Organizational Behavior. New York: Pearsons. Sh eehan, M. (1999), ‘Workplace bullying: responding with some emotional intelligence’, International Journal of Manpower, 20, ?, pp 57-69 Thomas M. (2005), ‘Bullying among support staff in a higher education institution’, Health Education, 105, 4, pp. 273-288. Vartia, M. (1996), ‘The sources of bullying – psychological work environment and organisational climate’, European Journal of Work and Organisational Psychology, 5, 2. pp 203-214. Zapf, D. & Einarsen, S. (2001), ‘Bullying in the workplace: Recent trends in research and practice – an introduction’, European Journal of Work and Organisational Psychology, 10 (4), pp. 369-373.

Thursday, November 7, 2019

Top 3 Time Management Tools to Meet Deadlines for Your College Assignment

Top 3 Time Management Tools to Meet Deadlines for Your College Assignment Top 3 Time Management Tools to Meet Deadlines for Your College Assignment College life can be incredibly stressful for many students if they are not organized properly. Every individual is different while some live without noticing how time runs fast, others can’t realize how to succeed in performing all the task from a schedule. According to the study â€Å"The Impact of Time Management on the Students’ Academic Achievements†, time management is highly related to the student’s academic performance. So, the ability to effectively budget and manage time will have a positive impact on your student life and not only. The time management skill is especially important to ensure that you complete all your assignments in due time. How to Develop Time Management Skills? Being a student, you should understand that every assignment is important and failing to deliver a top-quality one on time can play a cruel joke with you. There is a big difference between focusing on schedule and being forced to finish the entire year of education. Furthermore, good skills at managing time can help you avoid unnecessary stress. You’ll be able to free up time for extracurricular activities. Granted, not everyone is good at efficient time management but there are ways to improve and make time for the studies and relax. 1.   Create a Schedule and Stick to It One of the easiest ways to ensure that you manage your time effectively is to create a daily schedule for yourself. While you are creating your schedule, you can determine what activities are a top priority and what activities are not so important. By doing so, you can ensure that you leave enough time on planning, research, writing and reviewing your assignments before the deadlines. For this purpose, use the following online app: Google Calendar. It is an online platform where you can create your schedule for the studies at university or college. Set time for particular tasks and this app will remind you what you should do in the nearest time. 2.   Use a Time Tracker Experienced the situation when you planned to spend 20 minutes on a task but finally spent an hour? It is a common practice among students. It’s one of the challenges to stick to schedule time. It happens only because of the lack of an instrument that you would use to measure time. You’re lucky to be focused on time with the help of: Tomighty. It is a timer that can help you be focused on a task and meet its deadline. Make an oath to finish, for example, in 30 minutes. Plunge into an assignment until the timer rings. It allows you to rest at the same time by taking little breaks as well. 3.   Block Yourself from Different Distractions Look around yourself to see what takes your attention. Is it a social media site that you check many times while working on an assignment? Thus, it‘s time to take control of your success by means of: Stay Focused. It is a block application that allows to reduce the daily usage of distracting websites. It is much better to keep focused on the brilliant academic performance than to waste time on social networking or messaging. Later, after you finish a task, feel free to communicate with pen-friends at your leisure. Identifying useful tools and resources can help you better manage your time, whether you are a part-time student or a full-time freshman. Avoid missing important deadlines. The most important tip to keep in mind is to always list your assignments in order of priority. The sooner you complete the task, the lower your stress levels will be. Learn not to put off your assignments until the last minute even if they are small. Even if you feel you don’t manage to submit a paper on time, don’t worry. Our certified specialists in custom assignment writing are able to boost your final score within the shortest deadline.

Tuesday, November 5, 2019

Word Choice Compliment vs. Complement

Word Choice Compliment vs. Complement Word Choice: Compliment vs. Complement Tom Selleck has beautiful eyes. We know that’s a little weird for an opening sentence in a proofreading blogpost, but we needed to illustrate what a â€Å"compliment† is. And partly we’re hoping Tom Selleck googles himself and reads this. We love Tom Selleck. Just look at that gorgeous specimen. Anyway, back to work. Today we’re discussing the difference between â€Å"compliment† and â€Å"complement.† Given their similarity in spelling and pronunciation, it’s understandable that these terms are confused sometimes. Yet each word has a distinct meaning, so it’s important to use them properly in your written work. Compliment/Complimentary As indicated above, a â€Å"compliment† is an expression of praise or approval: When I met Tom Selleck, I complimented him on his bushy mustache. He shampoos it every day. [Photo: Alan Light]This sense of â€Å"compliment† can be used either as a noun when referring to the praise itself, or as a verb when referring to the act of expressing praise. Meanwhile, the adjective â€Å"complimentary† has two meanings. One is to describe something or someone as having expressed admiration: After we were done talking, Tom Selleck thanked me for being complimentary. The other is to describe something as having been provided without charge or as a courtesy: I offered Tom Selleck the complimentary chocolate from my hotel room, but he declined. Complement/Complementary The verb â€Å"complement† means to â€Å"add to† or â€Å"enhance† something by making it more complete or effective: Tom Selleck’s sunglasses perfectly complement his Hawaiian shirt. Something which â€Å"complements† something else in this way can be described as a â€Å"complement.† Sometimes â€Å"complement† is also used as a noun meaning â€Å"the number of something required for a full set†: I wanted to go to Tom Selleck’s party, but he said they had a full complement of guests. The adjective â€Å"complementary† has the sense of â€Å"adding to† or â€Å"enhancing† something, and is used when describing two things that are useful or attractive together: The complementary combination of good looks and charisma made Tom Selleck one of the most popular TV actors of the 1980s. Also, he was in Three Men and a Baby. [Photo: Georges Biard] Compliment or Complement? Whether or not you’re intending to praise Tom Selleck, it’s essential to know the difference between â€Å"compliment† and â€Å"complement.† Remember: Compliment = Praise Complement = Add to/make complete The exception here is when â€Å"complimentary† means â€Å"free† or â€Å"as a courtesy,† as this isn’t directly related to praise. But as long as you can remember this general rule, you should be able to avoid confusions in your written work.

Sunday, November 3, 2019

Marketing the Fashion Product Essay Example | Topics and Well Written Essays - 3000 words

Marketing the Fashion Product - Essay Example The essay "Marketing the Fashion Product" talks about the successful marketing strategy of the biggest clothes retailer in the United Kingdom Marks and Spencer (M&S). The lingerie market has grown steadily over the past decades with the United Kingdom experiencing consistent growth. M&S have grown consistently with new designs, innovative practices to record huge volume of sales in the last 5 years. â€Å"The total UK lingerie market was worth an estimated  £2.93bn in 2010, increasing by 17.8% over the 5-year review period.† M&S underwear brands consist of ‘Autograph’, ‘Per Una’ and ‘M&S Woman’ for women. For men it is ‘Autograph underwear’, ‘collezione’. Marketing has always been the nucleus of any business. There is no other alternative to reach the customers than a proper marketing plan and execution. The companies need to reach out to the customers and offer them the best services and quality at competitive prices. It is not necessary for M&S to provide cheap products as quality is the key to the underwear market segment where comfort counts. The twofold goal of marketing is to attract new customers by promising superior value and to keep and grow current customers by delivering satisfaction. The 7P marketing mix is a scientific account of the key areas of marketing which are Product, Price, place, promotion, packaging, positioning, and people. The idea of marketing mix is the same idea as mixing a cake. A baker will alter the proportions of ingredients in a cake depending on the type of cake he/she wishes to bake. The proportions in marketing mix can be altered in the same way and can differ from product to product.† (GCSE,2001) Product selling is a critical area where the customer habits and trends decide whether they want to purchase the product. Quality and innovative design are key factors where the marketers need to equip themselves with answers to critical questions as to the marketability and the acceptability of a product. Product demand and the trend of the market will decide on the sale of the product. M&S have the uniqueness in them where their innovative designers are constantly researching on the aspect of giving the customer an out of the box design. The body shape wear designed by their experts were special for the customers where they welcomed it and very soon it became the trend setter for the underwear brands. Apart from the core product selling, after sales services are also an important segment of product selling as it gives an element of trust to the company. Price is the second P of the

Friday, November 1, 2019

Executive ethics Research Paper Example | Topics and Well Written Essays - 1250 words

Executive ethics - Research Paper Example His executive roles in terms of ethical interpretation seem to have a rare following with a mixture of reactions that have apparently been masked by the success that the corporation has made. In tracing Zuckerberg’s track record as an ethical CEO, this discourse displays the two sides of the youthful Facebook icon. This section deals with a description of his ethical beliefs and practices at the helm of the leading social network. At Facebook, the corporation picture of professionalism is boosted by the founder’s belief that amassing the best professionally capable human resource will salvage the chances of operations. According to the executive approach that the CEO has adopted over the years, a very stable team of managers can only enable the corporation to rise from strength to strength. This is evidenced by the choice of his vice president and other top managers who have a rich history in dealing with corporate affairs. In view of the implication that the choices of the management team that Zuckerberg chose, we can draw an inference that he prefers professionalism in handling of corporate management at Facebook. The fortunes of the company on a backdrop of controversies illustrate an internal strength that professionalism accords Facebook. Under Zuckerberg’s tenure, Facebook’s corporate responsibility has evolved to keep in touch with the changing business environment. By facilitating one of the most time-progressive policies which acknowledges keeping up with the pace of environmental issues, Zuckerberg paints an image of a CEO who is conscious of ethical principle of corporate social responsibility. Facebook does not only lead in the pack for the campaign to promote climate change responsive agenda, it actually implements on of the most progressive green energy projects at its server facilities. Such community minded leadership is only made fruitful by the contributions of a youthful CEO under the guidance of some ethical principles. In a

Wednesday, October 30, 2019

Cause and Prevention of Type2 Diabetes in Urban China Essay

Cause and Prevention of Type2 Diabetes in Urban China - Essay Example Rapid economic growth after reformation has lead to lifestyle changes in China's population. Reduced physical activity and unhealthy eating habits inevitably lead to obesity and diabetes, and in fact such lifestyle changes have led to rapid increase in the incidence of Type2 diabetes in urban China. Furthermore, China has now overtaken India as the country with the largest number of diabetes patients in the world, with 50 million patients currently, and an annual incremental rate of 1-2 million. It is predicted that 100 million of China's 1.3 billion people will have diabetes by 2025. In urban regions of China, around 50% of Type2 patients are children. Type2 diabetes in children is easily overlooked, and delays in treatment can have serious consequences. Hence, medical experts warn that vigilance is essential to prevent and treat the disease in children. Lifestyle intervention will play an important role in diabetes management, particularly because insulin injections are too expensi ve for the majority of Chinese. First, a systematic review of existing literature will consider information about the following: causes of Type2 diabetes, medical treatments (effectiveness, cost and benefit), and lifestyle intervention approaches (effectiveness, cost and benefit). Following this, a number of methods will be used to gather and evaluate relevant data. Using the deductive approach will require starting with a general hypothesis; for example, "lifestyle changes are directly increasing incidence of Type2 diabetes and prevention strategies should be implemented". Inductive research, on the other hand, will allow the researcher to account for the possibility that there may be less obvious influences on the rising frequency of Type2 diabetes in China. A mixture of research strategies designed to obtain qualitative and quantitative data, such as questionnaires and interviews, will be applied on selected groups of diabetics, medical staff, schools, doctors and hospitals. Surveys and questionnaires will gather data used in the deductive approach, while interviews will gather qualitative data for an inductive approach. Various research methods used together will help cancel out the 'method effect'. (Smith 1975) Face-to-face interviews are essential to this research topic, and gaining qualitative data is the primary focus. Economic evaluation will involve a comparison of the costs and benefits of treatment versus prevention strategies. It is suggested that such a comparison will show that it is far more beneficial from an economic standpoint to prevent diabetes rather than to treat it. Feasibility Primary data will be obtained from publications by the World Health Organisation, China's Ministry of Health, and Official Chinese News Agents. A systematic

Sunday, October 27, 2019

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.